Index

1. BLAST
2. redundant DNA codes
3. Standard genetic code
4. FASTA format
5. NCBI Databases

BLAST

The Basic Local Alignment Tool (BLAST) is an efficient computer program for comparing DNA and protein sequences. There are several flavors of BLAST available:
1. BLASTP compares an amino acid query sequence against a protein sequence database
2. BLASTN compares a nucleotide query sequence against a nucleotide sequence database
3. BLASTX compares a nucleotide query sequence translated in all reading frames against a protein sequence database
4. TBLASTN compares a protein query sequence against a nucleotide sequence database dynamically translated in all reading frames
5. TBLASTX compares the six-frame translations of a nucleotide query sequence against the six-frame translations of a nucleotide sequence database.
Not all flavors are available at all times. The six-frame translations require a lot of processor time and are often limited in usage.

Return to index

DNA codes

symbol	base		symbol	base
A	adenosine		M	A C (amino)
C	cytidine		S	G C (strong)
G	guanine		W	A T (weak)
T	thymidine		B	G T C
U	uridine		D	G A T
R	G A (purine)		H	A C T
Y	T C (pyrimidine)		V	G C A
K	G T (keto)		N	A G C T (any)
			-	gap of indeterminate length

Return to index

Standard Genetic Code

This is the standard genetic code, Alternative genetic codes and modifications to this code are available from the NCBI.
Codons in bold are potential initiation codons.

		Second base
		T			C			A			G			3rd base
First base	T	TTT	F	Phe	TCT	S	Ser	TAT	Y	Tyr	TGT	C	Cys	T
		TTC	F	Phe	TCC	S	Ser	TAC	Y	Tyr	TGC	C	Cys	C
		TTA	L	Leu	TCA	S	Ser	TAA	*	Ter	TGA	*	Ter	A
		TTG	L	Leu	TCG	S	Ser	TAG	*	Ter	TGG	W	Trp	G
	C	CTT	L	Leu	CCT	P	Pro	CAT	H	His	CGT	R	Arg	T
		CTC	L	Leu	CCC	P	Pro	CAC	H	His	CGC	R	Arg	C
		CTA	L	Leu	CCA	P	Pro	CAA	Q	Gln	CGA	R	Arg	A
		CTG	L	Leu	CCG	P	Pro	CAG	Q	Gln	CGG	R	Arg	G
	A	ATT	I	Ile	ACT	T	Thr	AAT	N	Asn	AGT	S	Ser	T
		ATC	I	Ile	ACC	T	Thr	AAC	N	Asn	AGC	S	Ser	C
		ATA	I	Ile	ACA	T	Thr	AAA	K	Lys	AGA	R	Arg	A
		ATG	M	Met	ACG	T	Thr	AAG	K	Lys	AGG	R	Arg	G
	G	GTT	V	Val	GCT	A	Ala	GAT	D	Asp	GGT	G	Gly	T
		GTC	V	Val	GCC	A	Ala	GAC	D	Asp	GGC	G	Gly	C
		GTA	V	Val	GCA	A	Ala	GAA	E	Glu	GGA	G	Gly	A
		GTG	V	Val	GCG	A	Ala	GAG	E	Glu	GGG	G	Gly	G

FASTA format

FASTA format was developed by Bill Pearson and is one of the simplest formats for sequences. The basic format is as follows:

>sequence_id_1
gataggctgagcgatgcgatgctagctagctagc
>sequence_id_2
gatagctcgatcgatcggagcgatcgatcgagctagc


The identifier line always begins with a greater than sign (>), and is only one line. The sequence begins on the next line. Multiple sequences can be maintained in the same file. Some programs allow spaces in the identifier line, and some do not.

Return to index

NCBI Databases

These are the databases available from NCBI:

1. nr: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS, or phase 0, 1 or 2 HTGS sequences). No longer "non-redundant" but that is what the name means. It used to be the single unified database for everything.
2. SWISS-PROTSWISS PROT protein sequence database
3. month: All new or revised GenBank, EMBL (European), DDBJ (Japanese), and PDB (protein database) sequences released in the last 30 days.
4. Drosophila genome: Drosophila genome provided by Celera and Berkeley Drosophila Genome Project (BDGP).
5. dbest: Database of GenBank, EMBL, DDBJ, and PDB sequences from EST Divisions. Expressed Sequence Tags.
6. dbsts: Database of GenBank, EMBL, DDBJ, and PDB sequences from STS Divisions. Sequence Tagged Sites.
7. htgs: Unfinished High Throughput Genomic Sequences: phases 0, 1 and 2 (finished, phase 3 HTG sequences are in nr)
8. gss: Genome Survey Sequence, includes single-pass genomic data, exon-trapped sequences, and Alu PCR sequences.
9. yeast: Yeast (Saccharomyces cerevisiae) genomic nucleotide sequences
10. E. coli: Escherichia coli genomic nucleotide sequences
11. pdb: Sequences derived from the 3-dimensional structure from Brookhaven Protein Data Bank
12. Patent: Nucleotide sequences derived from the Patent division of GenBank
13. vector: Vector subset of GenBank
14. mito: Database of mitochondrial sequences
15. alu: Select Alu repeats from REPBASE (the repeat database), suitable for masking Alu repeats from query sequences.
16. Kabat's database of Immunologically interesting protein sequences
17. ESTs: ESTs from mouse, human, and other projects maintained as separate databases
18. EPD: Eukaryotic promoter database.

Return to index