In this tutorial we are going to learn how to load a DNA sequence into SeqWeb and then generate a restriction map of that fragment. This tutorial is to get you used to the look and feel of SeqWeb, and to indicate where and how you can get help. All the programs in SeqWeb have extensive help pages and so those will not be repeated here
Because of some technicalities with SeqWeb1, you will have to have two browser windows open, one with this help page and one with the SeqWeb window.
Click on the SeqWeb link to open SeqWeb in a new window. Note you will need a username and password to access SeqWeb.
The sequence that we are going to map is here Click on the link, and then save the sequence to your computer (using the File->Save command). Save as text. Notice that this file only contains one sequence. With SeqWeb a single file can have many sequences.
Now we are going to upload the sequence into SeqWeb. This will save the sequence on the SeqWeb computer that actually runs the programs.
Click on the
Sequence Manager link at the bottom of the screen to enter the sequence manager.
From this page you can upload, view, edit, and delete your sequences from SeqWeb by choosing the appropriate function button at the top of the page.
Click on the "Add" button, to add a sequence, and then choose "Local File". A new window will open where you can enter the name of the file. The easiest way of doing that is to click the Browse button and select the file from the list of files on your computer (you may have to navigate the directories to get to the right file!).
Once you have selected the file, click on the OK button once you have chosen your file and it will be uploaded. The information about the sequence will be shown in the window on the screen.
To make sure that your sequence uploaded properly click on the "View" button at top of the page, and then select the sequence. Click View to see it. The sequence from the link above is 4198 nucleotides long.
Now you have added a sequence. Note that you can edit, delete, copy, rename, save, and view the seqeunce from this page.
Now we want to return to the project manager. Click the
SeqWeb home button to return.
Now we are going to run the program Map that will draw a restriction map of this nucleic acid sequence. Click on either the small link on the left of the screen like this:
or the big link on the right side of the page like this:
When you enter the mapping program you have a lot of choices about how to display the results, all enzymes, six-cutters, and so on. Using the check boxes you can display only enzymes that cut once, or enzymes that cut multiple times. You can view translations of the DNA sequence along with the restriction sites.
When you have made all the changes, click the
run button. This window will change and display a clock something like this 
Click on the Cancel button to stop the program mid-run if you want to.
Once the run has finished a new window will open with the results. For example, the run I did had these results. The first 1 kb is shown below.
Map Results
(Linear) (MinSite=6) MAP of: unknown.seq check: 49 from: 1 to: 4198
WPDEF sequence
unknown sequence
Using Enzyme data from: enzyme.dat FileCheck: 4976
Restriction enzyme data file used by the programs MAP, MAPSORT and
MAPPLOT. A complete format description of this file may be found in the
Data Files manual.
Only one enzyme per recognition specificity is used when the
'*' is pressed to select all default enzymes. In addition,
enzymes that are commercially available but are not unique in . . .
Using translation scheme from: genmoredata:transl_table_01.txt FileCheck: 9349
transl_table = 1
This file contains the Standard Code specified in the feature table
definition, Version 1.08, formatted for use with the GCG programs
(Data Files volume of the Data Reference Set). It names amino acids in
both one and three-letter form and lists the codons which should
translate into them. All GCG translation programs may generate their . . .
With 151 enzymes: *
MaxCuts: 2
February 27, 2002 10:47 ..
CACTGCAGTAGTGCTGGCAACCCGTAAATATGTAGATGATAAGGCGCTGGAGCTGAAGGT
1 ---------+---------+---------+---------+---------+---------+ 60
AccI FspI
| |
ATATGTAGACGACCTGATGGCAAAGCATCTTGCTGCGCCGGACCCGCATTCACAGTATGC
61 ---------+---------+---------+---------+---------+---------+ 120
KpnI
Acc65I |
| |
GCAGAAGGACAGCCCTACACTCACAGGGATTCCAAAGGTACCGACGCCAGCGGCGGGTAA
121 ---------+---------+---------+---------+---------+---------+ 180
CAGCACTAAACAGATTGCAAACACGGAATTTGTGGCATCGTCTATCGCGGCAATAGTGGA
181 ---------+---------+---------+---------+---------+---------+ 240
TTCTGCGCCTGCAGCACTGGATACGCTGAACGAGCTGGCAGCGGCTCTGGGGAATGACCC
241 ---------+---------+---------+---------+---------+---------+ 300
GAACTTTGCCACGACGATGATAAACGCTCTGGCTGGAAAGCAACCGCTGGACAATACACT
301 ---------+---------+---------+---------+---------+---------+ 360
BbsI
|
GACGAATTTAAGCGGAAAAGATGTAGCTGGTCTTCTTGCATACCTCGGTTTAGGCGAAAC
361 ---------+---------+---------+---------+---------+---------+ 420
BbeI
SfoI |
NarI| |
MscI KasI|| |
| ||| |
GATAAATCTGGCCACTGGCGCCATGCAAAAAGACCAGAACTTGAATGATGTGCCAGATAA
421 ---------+---------+---------+---------+---------+---------+ 480
AGCGCTGGCCCGTCAGTCCCTCCAGCTTGGCAACAGCGCTACACTCAACGACGGCACCAC
481 ---------+---------+---------+---------+---------+---------+ 540
ACCAGACACTGTAGCCGCTGGTGACGACATCCGTATTTCCACCGCCAAAAGAGCTATAGA
541 ---------+---------+---------+---------+---------+---------+ 600
XcmI
AgeI | BlpI
| | |
CGACACCCAGACCGGTCTTGGTGCTCAGCCCGTTATGTGGGTAAGTACCGCCGATGATTT
601 ---------+---------+---------+---------+---------+---------+ 660
GAGCATTCTGCCGTCTGGTGCTCGCCGGTTTGCCAGCAATAAAGCTCCGGCAACAATATT
661 ---------+---------+---------+---------+---------+---------+ 720
AccI
|
GCCGGTAAACGATTATGTTTTCCTGGAAGTGATTGCCAAACGCGATTGCGTAGACGGCTG
721 ---------+---------+---------+---------+---------+---------+ 780
CGCCGTTCTGATAACAGACTCAGTTGGTAACACCTGGATTGGCGCGCGCTGGGACGCAAC
781 ---------+---------+---------+---------+---------+---------+ 840
CAATGATTCCGGGTTTACCTGGCGTCCCCTGATGTCGTGTCCGCCCGGCGTTCCCCTTCC
841 ---------+---------+---------+---------+---------+---------+ 900
EcoNI
|
GTGGCCGTCTGACACCATCCCTGCTGGTTACGCCCTGATGCAGGGGCAAGCATTTGATAA
901 ---------+---------+---------+---------+---------+---------+ 960
BspEI
|
GAACGTTTATCCCTTACTGGCAATAGCATATCCATCCGGCACTATTCCGGACATGCGCGG
961 ---------+---------+---------+---------+---------+---------+ 1020
The search was performed with 208 enzymes looking for only single cutters (MaxCuts: 1). I did not request a translation, and so none was performed.
At the bottom of the window there are three choices:
that allow you to save the results either as text or HTML or close this open window and return to SeqWeb.
In the BLAST section we will perform a nucleotide BLAST search against our unknown sequence
1For the technically inclined, SeqWeb relies on Javascript to run all the functions. While this is feasible to do with frames, it is quite difficult.